EST 504413 is a singleton


Sequence

>504413 (1 EST) Length=83 GGCACGAGATATATTAAAGAAAATAAAAAAAATATAGAAAATGTTTCAAATGTACTATTAAATAATAATTTTAATAAAAA TGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504413: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044131674597N975630651C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:13:7 on Sat 18 Nov 117.