EST 504424 is a singleton


Sequence

>504424 (1 EST) Length=387 ATATTCACAAGGTTCCATACGTAAAGTCGATGAATATAAATCGTGCTTACCTTTTAGATCTTTTGGATTTTTACCTAAAC GTATGTGTGACGTATACAAATGTGAAATTGGTAGAGTATATAAAAATGAAAATAACACAGATATTAGACCCATATCTTTT TATGTACCTAGAAAGAATTCATCAATATTTCAAGAAGATTTATATCCTCCTATTATTATGAGAGATCCTGAACGTAGTAC AAACAAATGGATTGATGGTATAAACCTAGATATTAAAAGGGTGTCTATAAAGGATTTAACCGAAGACGATTTATTAATTA CAAAAAAATTTAAACAACTTCCTAAGGAATCCAAAAGTATTCTTATTCAAGATAACAATAATCCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504424: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044241674608N975741019C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:24:45 on Fri 17 Nov 117.