EST 504429 is a singleton


Sequence

>504429 (1 EST) Length=275 AATTTAAAAAGAAGAAAAAAACATAAATATTAATTAAAATATATAATTGTAGTTTTATAAACAAATCGTATAAATATAAT AGTATTATATATCTTATCATCATATGATATACATTATATATATATTATATATAAATAAATTAATATAATATATATATATT ATATATATTTATATGTATAATCACATTTTATATACTATATATTTTTATTATTTCAACGNAAAATTGTTTATTTTAGAAAA TATACAGAAAAAAAAAAAATTANTGTGTGAGGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504429: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044291674613N975951028C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:31:54 on Mon 20 Nov 117.