EST 504436 is a singleton


Sequence

>504436 (1 EST) Length=408 ATATATATATATTTATTTATTTATTTATTTATTTTTATATTATAATAATAATAATACTTTTAAAAAAGATGAATAGTATA TTATATCTTGTCTTTCCTTATATTTTGTTCCTCATTTTATTGAGAACCTATGCTTATAAAAATCCTCGTTTTAGTTCTCT TAGCACTAATTCTGACAAGAATATTTCGGAAGATTTGAACAAATTATACAAAATAAATGAAGAGTTAGTTACAAATGAAC GAGAAGATGANGATGATGACGAAGATGATCAAGACGAATTACAAAATACAGATTTTGAAGACATCGCACACAAAAGTCTT GAAAGCGCTGAAGAAGAAGCAACCGTTGATCTAGAAAACGCAGAAATAGAAAATCTTCTAGACGAAGAAATATTTAGAAT TGCACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504436: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044361674620N976021035C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:40:18 on Fri 17 Nov 117.