EST 504437 is a singleton


Sequence

>504437 (1 EST) Length=399 ATAAAATGGGTGATATAGTTAGAACTATGGAACCCAAGAAAAGAAACAAAAATTGGAATTGTCCATACGTTGCTTTAATT AATTGAAAAATAGAAAAATATTTGAAATGATCTCTATTACTAAAAAAGGTAGCTAATTCATCAAGTGTCATTGAATGTAT AGAAGGACCTGCCCAATTTCCATATTGATAACCTGTTTCTTTTATTCTTCGCGTTTAAAAAATATTTATCCATGGATAAC TATGTACCTCGCGAGGATCTAAGCCATTATATATTCTTGGTGCACTTCCAGCCTTAGGAACTTTAAACATTTCAGAATTG GGATAATATGACTGTAATGTAGCGTTGGGAAATAAATATCTTATTTTGATCCTCGATATTGCCATTATAAAGACTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504437: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044371674621N976031037C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:32:31 on Sun 19 Nov 117.