EST 504438 is a singleton


Sequence

>504438 (1 EST) Length=394 AAAGTATCACGTTTATTTGTAACAGAAGGTACATTAGAATATTTATTATTAGATAAGATTAATATTCCAGAATGTTTCGG ACCATGTACTAAATTACATTTTAACAAAGTAGTTATTAAAGAATCAAAACAAAGAATATATGATATGACTATAAATAATG CTTTAGTACCAGAAATACAACCATATAACAGAAGAAAATATATGACTATCTTATATAAATGAAGCATATATTAAGAATAT AGTTTCAGATGCATTAACCAGTGAAGAAATAAAAAGACATGATATCCAAAAAGGTAATATCAAAATATGTATGGGAAAAA GCACATATCTTACAGAACCTATATTAACTGAAGAACATTTCAATTTAACTCACAAACCAGTATATGATTTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504438: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044381674622N976041038C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:9:25 on Sun 19 Nov 117.