EST 504445 is a singleton


Sequence

>504445 (1 EST) Length=327 AATAAATCTAAGTGAATCTGTAACACAAAATATTATAAATTCTTTACTTAAAGAAATAGAAAATAACAAAATGCCTGTAC AAGAAATAAATGACAAAATTCAAAATGCAAATAATAAAAAGTTAGATAACCAAAATGTGAATAATGAAACTACTCAAAAT ATACGCTCAAATGTAATTTCAAATAAAACTAAAAAAACCTCAAGTGATAAAATTAAAAAAAAAACAATNCATATTGNTCA AGATACATTAGAAAATTGGTTATTCAAATATTTTAAATTACTTGGNCAATTGTGTGCAAAAATATTGACAGATAATAGAA ATATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504445: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044451674629N976111050C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:1:2 on Wed 22 Nov 117.