EST 504446 is a singleton


Sequence

>504446 (1 EST) Length=387 TAATAAAAAAAATATTATAATTTTTGGAGGTATTAATGAAAAAGATGAAATTGTTGATGAAACATATAAATTTGATTTCC AAGCAAGGAAATGGGAACTTATTGGAAATAAAATTTGTCCACGTGCAAGATATAAGCATGCTTCTTTCAGTTTTAATGAT TTTTTATATATTCATGGAGGATTAGATGTTAATAATTCCTTATTAGCTGATATGTGGNGTTTCTCTAAAAATTCATGGAC ACCAATTAAACAAATAGATAGAATTCCTGAACCAAGATATGCTCACAGTTTAATATTTTCGTTTTATGGAAATGCTAAAT TGGNGTTTTTATTTGGGGGTAATAAAAAGGGATATAATGCAGCTTTAGGTGATACATGGATTTTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504446: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044461674630N976121051C3czapPFDd2.1, Debopam Chakrabarti


Date: 8:52:48 on Tue 21 Nov 117.