EST 504452 is a singleton


Sequence

>504452 (1 EST) Length=391 ATCATTCCAATTGTTTATTAAGCTAGCTGGACATAATATTAAACATCTACGTACAGCGCACTTTTTATGAAATCCTTGTT TTAATAAAGTATATAAAACAGTTATACTCTGTAATGTTTTTCCAAGACCCATGTCATCAGCTAATATACATCCACTTATT TTATCATCTTTTATATTCATTAAACATTCAAAAACAAATTGAACACCTTCTCTTTGATGTTCTCTTAAATATTGAGCTAA TATAGGATCAACCTCAATCTTATCATTTTCGTCTTTGTATAAAATTAACGGCTCATGCTTTTTTATAACTTCTTCGATCT TTTCTTGTTCTTCTGTTTCATCAGATCTTCTAGGAATAGAATTCTNCATCAAATTTATCCAACCTGTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504452: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044521674636N976181060C3czapPFDd2.1, Debopam Chakrabarti


Date: 7:33:33 on Sun 19 Nov 117.