EST 504454 is a singleton


Sequence

>504454 (1 EST) Length=366 ATTTGAATCCCAATTTTTTCCCTCAACAATCAAGGCAATATTCTTATTCAGTTTCCCCAACGTATCAACAAAACATGCCT AATTTTAATAACTTTTCAAATAGACATATGCCATCTATGTCTGATTTATATTTTGCAAGACAATATTCAGGGATGAAATT TGGGGACATGAATAACAGTCCATTTGATTCACAGAAACCATATAAATTTTAAGCAAAAAAAAAAAGAAAAAAAAAAAAAA ANCAGATCAGGTCTCCATTTTATTATAAAGGAGAAGCGCACCTCTCCACCCGAAAGGGGACATAAAAAAGAAGCGACAAT TTAGAAAAGGATATGGGATACCACAACAATAAAAAGGGGAAATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504454: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044541674638N976201062C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:16:52 on Sat 18 Nov 117.