EST 504467 is a singleton


Sequence

>504467 (1 EST) Length=384 CGGGGTTAGATAATGGTTTAATAAAAATTATGCATCTACCTTCATCAGATGCATCAACACTTTATGCCCATACAGATTCT ATTTATAGTATTGTTTGTATTGATGGTATTATTATATCATCATGTATAAATGGTGAAGTAAAATTTTGGAAATATGATGA AACATGTTCAAGATTTGTAGCTATTAAAACTATAGAAACAAAAACAAAAATTTATAAAATGATTGAAGTTATTTCCCCAA AAGCTGCTACGAATATAAATAATAACAATACTGAAGATAATAAATATAATAGAAATTTATGGGTTTGTGGAGATAGTATT ACTATCATTAACTTATTAAATTTAGAAATTGTTAATAATTTTAAATGTAAATATGGTAATGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504467: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044671674651N976331081C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:25:57 on Thu 23 Nov 117.