EST 504489 is a singleton


Sequence

>504489 (1 EST) Length=115 AAAAGCACCTCATTTTGCAATTTTNATAATATATATATATGTAATTTTGTTATATTTTATATATATAAGAACTTTTTTTT TTTTATATATATATATTATANNNNGTATTTATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504489: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044891674673N976550771C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:57:3 on Mon 20 Nov 117.