EST 504515 is a singleton


Sequence

>504515 (1 EST) Length=123 CTGCTGCAATTCTTGAAGAAGATGATTCAAAAGATGATATGGAATTTAAAGCTTCTCCTTCAGTTGTTAAAACATCTACT CCATCAGGTACACAGACATCTGGTTTAAAATCATCTAGTCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504515: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045151674699N976811005C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:7:13 on Sun 19 Nov 117.