EST 504516 is a singleton


Sequence

>504516 (1 EST) Length=403 TTATATTGTAGAATTTTTAAAATATGATGATAAAACTGACTTACAATTTGAGGCAGCTTGGGTTATAACTAATATTGCAT CAGGATCACAAGAACAAACTAAGGTAGTCATCGATAATAATGCTGTTCCTCACCTTGTTAGGTTATTAAGTAGTGAAAAA GAAGATGTGTGTGAACAAGCCGTTTGGGCTTTAGGAAATATTGCAGGTGATTCTGCTGAATGTAGAGAATATGTTTTAAA TCAAAATTCATTACCATTATTATTAAAAATTTTACGAACCAGCCATAAAAGAACTTTAATAAGAAACGCTGCATGGACCT TATCTAATTTATGTAGAGGTAAACCTGCACCAAAATTTGAAATAGTTTCCAAGGCGTTACCAACATTAGCTGCCTTAATA TAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504516: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045161674700N976821007C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:45:50 on Thu 23 Nov 117.