EST 504520 is a singleton


Sequence

>504520 (1 EST) Length=371 AATTTTTTTTTTTTTTCTTTCTTTTGTTTCTTTTCTTTTTTCATGTCCACAGTTCATTTTAAACATAAAAGTGTATTTTC CAATAAAATAAAAATAACGAATTTTTTTTTTTAATATCAAATTAAATAAAATCTATACATCTCGATATATTTATAATAAA TAAATTAAAAAATATATATATATATAAAAAAATGACTTTGAAAAAAATATATAATGGTCATTTCCGGAGAGTACCATCAA GCAGCGAGAAGGCTGACAAGAGTTTTTGGAGTGAAAAATCAGCTGAAATATTAAGTGAAAGCAAAAGTTTTGAAAATAAA GGAGGTTATGGAATCGAAAACAATATTTTATATGGGGCAGGTTTAGGAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 504520: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045201674704N976861015C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:20:55 on Fri 24 Nov 117.