EST 504545 is a singleton


Sequence

>504545 (1 EST) Length=325 ACAAAGAATCTTTATTAAATCTTATAGGATTAAGTGAAAATAGGAACTCAAGGAAAAATAGAAGAAGAAAAAAAAAAAAA GGAAAATTAAAACAACCTTTCCCTGAAGAAAAATTATGTTTATCAGATTCTGACATGCGTAGGAAAAAATTCATTTTAAG AACTTATNGTGATGTTAATTTCAATGTGACATGTACTACCAAAAAAGAGCGTAATTCAATTTGATCTTTTAAGCTTATCT TTTTATTTAATGTTTAATTTTTTAGTTTNNCCTTATATTTATTTATTCCTTTTTTATATTAAATTATTGTAATTCAAATT AATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504545: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045451674729N976951125C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:23:15 on Fri 24 Nov 117.