EST 504546 is a singleton


Sequence

>504546 (1 EST) Length=289 CTCTTATATATTTTATTTCATATCAATTTATTTTTATTTTTATTTTTTATTTTTTATTTTTTTTTTGGAATGTGTAGGGT TGTTTATTTTTGGCTTTAGTAAATAGGAAAATGATATAAATGAGCAAGATTGGGTATAGTAGAAATTTTAAAGTTGATAT ATATCAAAAGGAATAGAAAGGAAGAAATATAATTAAAAATATAAATAAATAAATATAAATATAAATCTATATATATATAT ATATATATATATATATATATATATATACATCTACATTTATATATATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 504546: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045461674730N976961126C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:4:19 on Wed 22 Nov 117.