EST 504553 is a singleton


Sequence

>504553 (1 EST) Length=329 CATTTAAGGCAGATGCTATAAAAAGACAAGATATTTTAAAAAGTGAAGAAATAAAAATACGAGATACATTTAAAGCAGAT GCTATAAAAACACAAGATAATTTAAAAAGTGAAGAAATAAAAATACAAGATACATTTANNGCAGATGCTATAAAAACACA AGATATTTTAAAAAGAGAAGAAATAATAATACAAGATACATTTAAAACAGATGTTGTNAAAGCGCAAGGTAATATAAAAA GGGAAGAAATAATAATACAAGATGCTTTTAAAAAAGATGAAAGGAAATCTCAAAATACGTCCAAAATGGATGAAATAACA ATACAGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504553: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045531674737N977031144C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:48:59 on Thu 23 Nov 117.