EST 504554 is a singleton


Sequence

>504554 (1 EST) Length=338 AAAAATATGAGAGAAGCACAAAATGTCATAGACCACGGATTAAATAGTGTACAGTATTTAAAAATAAGAAATTACAGAGA TAAGGAAAGTAGTTTCACAATTTTATGTCCATTCATGGAAGGAAACGACAAAAACATAAGAGAACTCGAGAGAACCCAGA TATCTCTTTTTATTCACAAAAACATTGGAATGTCTAGAATAATCAAAGGAAAATTGATCAATATATTTAAAAAAACACTT AATATGAGGGAAGGTATTAAATCAGATAGTGCCATATCTATAAAAGTTGGAGCACGTNAATATAATGGTATCATATTCAC AGGAGGATATCAATTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504554: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045541674738N977201148C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:4:9 on Fri 24 Nov 117.