EST 504555 is a singleton


Sequence

>504555 (1 EST) Length=333 CTTTTTAAGAATGTAACTAAAACGAATACAATTCAGTGAAAACATAAATTAATTTATATATGAAAATAGATTATACATAT ATTTAATATTGAAAGTATTATATATATGTATATTTTTTTTGTTTTTTAAAACTTAATATTTATATAATATTTATTTAACA TTTATATAATATTTATTTAACATTTATATAATATATATTTAACATTTATATAATATTTATTTAACATTTATATAATATAT ATTTAACATTTATATAATATTTATTTAACATTCATTTAACATTTATATAATATTTATTTAATATATATAATTTTTGTTGT ATATTTTTGTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504555: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045551674739N977211149C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:56:24 on Wed 22 Nov 117.