EST 504556 is a singleton


Sequence

>504556 (1 EST) Length=413 ATCAGCTTATTATATTATAATTTTTTTTTCAAAGAGTTTATATATATAAAAAAAAAAAAAAGGAAAAGAAAAANTATACT GTAAGTTAAAAAATGGCATATGTAANGGTTGTTAAAAATAAAGNATACTTTAAAAGATACCAAGTGAAATATAGAAGAAG AAGAGAGGGAAAAACCGACTACAGGGCTAGGAAAGCTTTAATATTACAAGACAAGAATAAGTATAATGCTCAAAAGCTCC GTTTTGTTGTTCGTAAAACAAATAGTCAGGTAATATGCCAAATAGCTTGTGCACATATTGAAGGAGATAAAATATTAGCA GAAGCAAAGTCAAAAGAATTGATAAGATACGGTATCCCTGTTGGATTAAAGAATTATGCAGCTGCNTTATGCCACCGGTT TATTGTGTGCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504556: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045561674740N977221150C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:12:24 on Sat 18 Nov 117.