EST 504557 is a singleton


Sequence

>504557 (1 EST) Length=372 CTAGTCTCGAGTTTTTTTTTTTTTTTTTTTATTTTGAATTAAAGAGAATTTGGAATTTTGTTTTTATTTAGGGAAGAAAA ACAAAAATTAAAAAAGAGAAAATAAATTATCACATTAATATTATATTATATATATATTATATATATATATTAGCATAATA TTTCCTTAATTTATAATAATATCCTTACTTAAACTATTTTTAAAAACTTTAAAACATAAAAAGAAAAAATAACATATATA TATATATATTATATATATATNNAAAAAAAAAAAAAAAAATTTTTTATAAATGGNTACCATAAGACCTGTTGCAAATGTTT ATAGTACAAATGGAAAGAACGTCGTTGGCGAAGTAGAAATACCAGTCGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504557: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045571674741N977231151C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:1:10 on Sun 19 Nov 117.