EST 504559 is a singleton


Sequence

>504559 (1 EST) Length=382 GAAGATATTCCGTGTGATTTGTTAAGAAAGAAGTATAAGGAGTTATTTGTACCAACTATAAGTGTATTAGATTTTAAAAA AAAAAGATTATACCGAAAATACAACAACATCTTTTTATATACTTATAAGAATTACTCTTTTTTGTGGGAATTAGAAAATA ATATTCTTCATAAGGTACAGAAATGTTTAAATAAAAATGGTATATTAAAATTAATAATTTATTTAAATAAAAATGACGTT ATAACACCGGATAAACATGAAAATAAAAATAATAACGACATAAAAGTCAATATAGATCAAAAAGATTATTGTGAAAATTA TATAAATGACATTTTTAAAAATATAAAAAAGGAATGTTTATATAACGGATTTATAAATATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504559: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045591674743N977251154C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:48:49 on Thu 23 Nov 117.