EST 504562 is a singleton


Sequence

>504562 (1 EST) Length=372 AAAAGGTGAAGGAAATAATGAAAATATTGTGTTTTCATTAAATAATAATGATACAAAAAATATGGAAGGAATTATGTTGG ACACATATTCAGATTATTTCAGAAAGTTAAATGAAATAAGTCCAAATAGAATAGAAAATGAAAGAAATCATGATAATAAT AATCGTGAAGAAAGTAGTTGNTCATCATCAGATGACTCGTCCAATTACAGTTTTGTNTGTACAAAAAGAAAAAATGAAAA TAACAACANCTTGAACAAAAAAGATATTAGCGAGAACACGGAATATGAGAACAATAAGGATAAACTTAATTTGANTTTTG AATGTATTAATGAAGTTCATAATGAAAAAGAGGAAAATGCAGATAAAAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504562: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045621674746N977281157C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:58:16 on Sat 18 Nov 117.