EST 504563 is a singleton


Sequence

>504563 (1 EST) Length=401 GTCAAAGGTCCTTATATCACCTCCTCATGGATAGATTACTTAGAAGACTGTGGTAATAAATCACAATTCAGAAATAAATT TAATAGTATACATAATTTTAAAAAATTATATTATAGTAATACTGTTCTTTGGAGAGGTAATTTTTTTCAAATAAAAGAAG GATTTTTAAATAGTAATTCTTTATATATCAAAATGAATCCATCAGAATATAAATATGATAGACCAGATATTAGAGCACTC TTTAATAATAATTTGATTTCGCAAATAGAAAATTTACAAAAAAATGATTATATCGAATTTGAATGTACCTTAATAGAAAT AAGTAAAAATAAAAGTCCACATTTATGTCTTCTATGGAATGTGAAGCTTATAGAAAAATATCAACCAAAAAATTTAAGTA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504563: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045631674747N977291158C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:43:32 on Sat 25 Nov 117.