EST 504565 is a singleton


Sequence

>504565 (1 EST) Length=333 TAAAGCTTGAATAATAATGTAGATTAAAAACATTATATATATATATACAAATATCCAAAAAAATTATATACACATATATA AACATATATTTATATATATGTATATATATTTNACAGCACATTTATTATTATCTTAAAATTTCAGTTATAATATTATAAAT GTTCTGGATATAAATAATAATTTGATATAAAATATATAAAAAGAAGAAAAAAAAAAAAAAATANTAATAATCCATCTTTT AGNCATTTTGTATTTAAAAATAAAAAAAAGATTATAAATAATAAAATATATAATGAGTAAAGAAGTAGTAAATACAAAAG CTGAAGCATCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504565: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045651674749N977311160C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:50:48 on Sat 25 Nov 117.