EST 504566 is a singleton


Sequence

>504566 (1 EST) Length=334 GTTAATTCAAAAGGAGATGAGAATACAAAAAAAACTGAGTAACACAATAAATGACAAGGAAACGATTGATATTATAAATA AAAAGAATTCATCAGAATCGGTAAAAGAAGAAATAATGGAAAAAGAAATGTTAGATGAGAAAGATAAAAATGTACCACAT TACTTAGAATGTAATAATTTACATAATATGGATGAAGTTAATTCAAAAGGAGATGAGAATACAAAAAAAACTGAGAACAA AATCAACAAAGAAAAGATAAAATCATTACTAGTAATGAACTTATNGATCTTTGTGACAACATAGAAGAAAAAAATCCTTT CTTATTTTTTCCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504566: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045661674750N977321161C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:15:49 on Fri 24 Nov 117.