EST 504571 is a singleton


Sequence

>504571 (1 EST) Length=388 ATACCGACCAGTAATTTAAAATCCGAAGATGATGCTTTAGCCTTACAAGAAGAAATGATGACTAAAGCTGGTCATCGTCT ATATAGATTAACTCAAATGTTTTCAGCTACTATGCCTCCATCAGTAGAAAGATTATCAAGAAAATATTTAAGAGCACCTG CATATATATCTATTGGTGATCCAGGTGCAGGTAAGCGATCGATTGAACAAAAGTTGGAATTCCTTACAGAAGGAAAGAAA AAACAAAAATTACAAGAAATATTAGAAATGTATGAACCTCCTATAATAGTATTTGTCAATCAAAAGAAAGTTGCAGATAT TATTTCTAAATCAATAACAAAAATGAAATATAAAGCAGTAGCATTACATGGAGGAAAAGCTCAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504571: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045711674755N977371171C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:10:7 on Sun 19 Nov 117.