EST 504573 is a singleton


Sequence

>504573 (1 EST) Length=405 AAATACCACTACTTTTAAAGTTGTTTTACTTATCCATTTATAGGGAAATATATTATGCTTTATCCTTCGGGAAGGCATTC TGATATTATTTGAATTTTTAAGAAACTTGTTTCTTATCTTTCTCCCAATTTCTATGGAGACATAGCCAGGTGGGGAGTTT GACTGGGGCGGTACATCTGTTAAATATTAACGNAGATGTCCAAAGACAAGCTCAAAGAGAACAGAAATCTCTTGTNGACT AAAAGGGGAAAAGCTTGTTTGATTTCTATTTTCAGAACAAGTAGAAAACGTGAAAGCGTGGCCTATCGATCCTTTATATT TGCAAAATGACGTNAATTACTTACTACTGCGCATATAGAGGTGTCTGAAAAGTTACCACAGGGATAACTGGCTTGTGGCT GCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 504573: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045731674757N977391176C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:38:20 on Sun 19 Nov 117.