EST 504575 is a singleton


Sequence

>504575 (1 EST) Length=426 ACCAAACCTTGTAGCTGAATCAACAACAATAGAGAAGGAACCGATAGACAAAATTATTCCAAGAAGTTTCTCTAAATCAT TAAGCATTCCTATGAAAGTGCCTACAATAAAAGAAAACATAAATAAAGCAAAACCAACATTTTGGAATAAACCCAAAGGG AAAATGTTCTTTTTGACCAAAAAAGAAAAGAGCATTTCGCAAGCAAAGGAAATTTTAAGATCTCTTGAAAAATCAAACAA TTGAAAGGTTTAAATGAAATATGGATATTTCAAAAGGGATACAATGATTTTTTATTTCATAATTTTTTTTTTTTGTTTCA TAATTTTTTTGTTCTTTGTTTCATAATTTTTTTGTTCTTTGTTTCATAATTTTTTTGTTCTTTGTTTCATAATTTTTTTG TTCTTTTTTGTGTTTTTCTTTTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045751674759N977411181C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:39:12 on Sat 18 Nov 117.