EST 504576 is a singleton


Sequence

>504576 (1 EST) Length=365 TATTTAGATCAAGTAGTAACTGGAGAAGCAATATCTGTCACAATGGATAATATCCTCTCAGGATTTGAAAATGAATATGA TGTTATATATTTAAAACCTTTAGCTGGAGTATATAGAAGCTTAAAAAAACAAATTGAAAAAAACATTATTACATTTAATT TAAATTTGAACGATATCTTAAATTCACGTCTTAAGAAACGAAAATATTTCTTAGATGTATTAGAATCTGATTTAATGCAA TTTAAACATATATCCTCAAATGAATACATTATTGAAGATTCATTTAAATTATTGAATTCAGAACAAAAAAACACACTTTT AAAAAGTTACAAATATATAAAAGAATCAGTAGAAAATGATATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504576: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045761674760N977421183C3czapPFDd2.1, Debopam Chakrabarti


Date: 22:22:10 on Sat 18 Nov 117.