EST 504580 is a singleton


Sequence

>504580 (1 EST) Length=413 AAATACTTAAGTACATTAAAAATAGCCATAATTAATAATCGTCATATAATACTCTATGGATCTTGTTTATTAAGTTTAAT AGAAATAAAAAATTATAATTTAAATAGCTCACATAATCCTTATGTTAAAGAATATGAATATAAATATTTAAAACTTATAT TTAATTTATACTGTTTTGAACATTTCAGTAATGTTTATGATACCTATGTCAACAAATTATCCTATGACCTAAAGCATCAT CTGGTAAAAAATGATTTATTTAAAAAGGAGAGAAAAAATAGCCATTTGTTTTACCTGAACAAGTCAGGCGAAAATTGTGA TCCAAATGGAGATATATCAAAAGGAAAAGATAGATATATACAAAAAAAAGAACAAGTGAATGAAAATATGGACATATATA ATAATAATAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504580: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045801674764N977461190C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:34:38 on Sat 25 Nov 117.