EST 504583 is a singleton


Sequence

>504583 (1 EST) Length=279 AATATATAGAACACGAAAAAAAAGAAGAAGAAGAAGATAAAGGTAAATTATATAATGGTGTATATTTACATGAAGTAAAT ATAATAGAAAATATAAAATATTCTGACTGTAATAAAATATACGATGAAAATATATTTCCTATTAGTATAATAGGTGATAT GTATATAAATAATATAATTCAATTTAAAGATAATTCTCCTTATCATTCTATTTATAAAGTACATAAAGTGGAATGGTTTT TANGTATAGATATTAATGAAGATACTATATCTGAAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045831674767N977491193C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:18:18 on Thu 23 Nov 117.