EST 504591 is a singleton


Sequence

>504591 (1 EST) Length=462 TGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGTTTCGATCGTTACCTTTAGAAGA AAAATATGCAGATAAGAAAAGGCTGGGGGTCATGCGAAAAAAATTTACGGATGTGAAGGATAATAAAAATGCCTTGGTGA CTTTGAAGGAAGAAAAAGATGTTCCCCTTTTACTGGAAAGAAATGGCACGGTATACGAAGGGTATGTTTTAAGGGTTAAT AAATTTGGAGATAGCAAATCGTTCAGTAGGAAGAAATCCATATGTATTAAAAATCTTTGCAAGAAGTTAAATGAGAAGGA CTTGTACGAAATTATGAAGGATGTGGATACAATAAAGGGTGTTAGAATATTGAGAGACACTGCAACTAGTATGTCAACGG GAACAGCATTTATTTTATTTGAAAGTCGAAGTGCTGTGAAAAAGGCCATACAACAATTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045911674775N977571203C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:58:28 on Thu 23 Nov 117.