EST 504599 is a singleton


Sequence

>504599 (1 EST) Length=394 ATTTAGATGATGCTTTATGCTTAGGTATGGATTGGTGTGTAAAAGAAGGATATTCATGGATCGAAGATAAATTAAATTGT GAAGATAATGGTAGAAGTCTATATGCTGATAGTAATTTTGTTTCCATAAGGGCTAAGAAAAGAGGAATAACACAAATGGG TACATTAGGTGCAGGAAATCATTATGCTGAAATACAAATTGTTGATCAAATATATGACAAAAAAAGTGCTAAATTAATGG GTATTGAAAAAAAAAATCAAGTTTGTATTATGATTCATTCAGGAAGTAGAGGCCTAGGACATCAAATAGCCACAGATGCA TTAATAGATATGGAAAAAAGTATGAACAAATATAAAATTAATGTGATCGATAAACAACTAGCTTGCACACCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045991674783N977651222C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:42:11 on Sat 18 Nov 117.