EST 504604 is a singleton


Sequence

>504604 (1 EST) Length=409 AATGTGAAAATGGGTTCTCTATAGAAGTTATTAATGCATATGTATCATGTTATAGAGTTTCATTCAATCTAAACAAATTG AAATATGTTACAGAATCATTAAAAAAAATGTGTGATGGGAAAACCAAATGTGCTTATGGAAATACAATAGATCCAATAGA TGATTTAAATCATCATAATATATGTAATAATTTTAATACAATATTTAAATATGATTATTTATGTGTATTCAATAATCAAA ATATTACTTCAGATAAGAATTCACATCTTCATTCTAATATACCATCATTATATAATTCAAGTATTCTACCAGATATTAAT AAATCTAAATTCCATTTGATTTCAAGAAATAGTCGAACCAACCAATATCCTCATAACAATATATCCATGCTAGAAATACA AAATGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046041674788N977701234C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:20:56 on Wed 22 Nov 117.