EST 504605 is a singleton


Sequence

>504605 (1 EST) Length=419 TGAAGTCGGGTTTGTATACAAATAATGATGACAGATCAGATAAGTCATCAATATGCGAATGTATCGATACTAATAATACA AAATTAGCAACAACAAAAGGAAAAGATAAGTATTTAAAACACTTAAAACACAGATGTACCCGTGGTATATATTTTTGCTC AGTAGGTAGTATATTCTTAACATTTATAGGTTTGTATGCTGCTAAAGCTGCTGCTGTTGCTGTCATCTCTCCTACTGTAT ATGAAGCAGCGATTCAAAATTGTGTATCCTCTAGTTCATTTTTATATATATTTGAGGGTGGTTCATTAACTGCAGCTCTT AAAGCAGGTGGTACAACATGTGCAACCGCTGTATCCGCCGATATAGTCACACCAGCTGTAGGTGCTGCTATTGGTGCATT TCCCCCCTATGGTATTGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 504605: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046051674789N977711236C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:30:20 on Thu 23 Nov 117.