EST 504619 is a singleton


Sequence

>504619 (1 EST) Length=246 AATCTAATTTTGATTCCAAAACTCCTGAAATAAAGGAAATAAATGAACCAATTATAGTACCTTCATATTATCCAACTACT GGTCCAAATCCTAATACCCATGGACCACCAAGNAGAAGAATTTCAACATCTAGATCTTCTGGATCGNCCAATAGAAGTTC ATCAGGAACTAGTACAAGATCCAAAGGTCCTTCTAGCCCATTACGCGATTCTTCAGGAAGATCAAGTGGAAGAAGTACCA CACCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046191674803N977851256C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:10:26 on Mon 20 Nov 117.