EST 504626 is a singleton


Sequence

>504626 (1 EST) Length=292 ACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTGGTATATATTCTTTACTAAATTTCATACTATATATTTATCATGATGAAA ATAATAAAGAAGAATTAATTTATTATGAATACATATTTTTTAAAATAATGGAATGTNAATATACATATATATATATATAT ATATATATATATATATATATATATATATATATATAACATATACATACATATATGAATAAATACATATATACATGTTTTGG GAATGTATCATATTCCCCTAAACTNTCGAATGAACAGATTGATGATATTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046261674810N977921267C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:44:9 on Fri 24 Nov 117.