EST 504632 is a singleton


Sequence

>504632 (1 EST) Length=297 AAATATTTTCCTATCAAACTCTTTGGTTTTGATTATGCGCGACGTTTGGCTATATATTGTAAAATTCATCAGAAAATACC TGAAGAAGCTTTAAATTTTGAACAAGCTTATAGAGCTAATCAACAAAATAATAAAGCAAAAAATGAAAACACACAAACGG GTGGTAGTAGTAGTAGTATCAGTAGTAACTCTATGAAATTGAAAAAAGGACCTAAGAAAAATTATGGCAAGAAGAGTGNA AATATAAATGAAGGGGGAGATATAAATGGTGGGGGAGATATAAATGGAGAGGGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046321674816N977981280C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:21:7 on Thu 23 Nov 117.