EST 504641 is a singleton


Sequence

>504641 (1 EST) Length=380 CCTATTTATTTCCTTTTTCTTCGATTTTGATATTTACCAATGTTTGTTTGGTTGCCCCTTAAGGGAAGGTTTCGATTCAG GGAATATATACACCTTCTTGCATTTCTTAAATCCATTAAAGTTTGATGAGCTGACAAAAGTGTATGCCCCAGCATATTCA TAGAGAAGCCAATCATTAATATAACACTCAGGTAAGTACGTAATAGAATTGATCATATCCAAGCCATCACATGATTGTCC AAATACATTAGCTAAATACAAATTAAAATTCATAAAATTTTGATTAGGGTTATTTTTGTTTTTAATAACATAAATAGGAC ATCTATTGTNTTCATCAAAAATTATACCACTAAAACAACCATATATACTATCGCTTACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504641: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046411674825N978071291C3czapPFDd2.1, Debopam Chakrabarti


Date: 7:37:4 on Sat 18 Nov 117.