EST 504650 is a singleton


Sequence

>504650 (1 EST) Length=358 AGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTCTTGGTATTTGTGTACATTAGCGTGTAGCTAATAAGTAAAT AATAAAATTAGCTCTTTGACATAATTTATAAAATAAAAACATATATATATATATATATTATATATTTTTATATATATATA TATATATTTATAATATATATAATATAATATATATTATTTATGATCCCTCTATGTATCGATAAAATGTATGTTATGTTTTT ATATATCTTCAATAAGTCAATGTATATAAAAATATATGAACAAATATATATATATAATAAAAAATATATATATAATATAA TATATTAAGTAAATACATACAACATTTATAAGAATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 504650: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046501674834N975761311C3czapPFDd2.1, Debopam Chakrabarti


Date: 3:45:13 on Sat 18 Nov 117.