EST 504651 is a singleton


Sequence

>504651 (1 EST) Length=229 ATTAAATCCACGATCTAGATGTTATAATAGTGTACATAGAACTTACATAAATGTTATTCATATAAAAAAAGAAAATAAAC AAAAAATGAAGTTAACTGAACAAAATGATACTGCTAATATTATATTAAAAAGAAATGAAGATGGTACAGTAGAGGAAAAT TTTGAAAAATTAAATGAACAAGGAAATTTATTATTTACAACCGAAGTTATTCAAAAAATTGAACAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504651: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046511674835N975771313C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:3:15 on Wed 22 Nov 117.