EST 504654 is a singleton


Sequence

>504654 (1 EST) Length=239 TAGATACTTCTTTCTATAATGAAAATAGTTNCACAAAGAACTATAGAACTGAAGACATGAAAAAAAGGCCAAGGTTTTAC AAACGATTTTAGTGATTTTCATCGTGAATTTTATGAAGAAGTTCATAGAATGAGAGAGCATGAAAGAAATGAACAAAATA GAGTAAACCAAAAATTATAACATTTTAAATTGTTAAAAAAACATATATATATATATTTATAATATATATTTTTTTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504654: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046541674838N975801320C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:50:13 on Wed 22 Nov 117.