EST 504655 is a singleton


Sequence

>504655 (1 EST) Length=330 GGCGGCCGCTTTTTTTTTTTTTTTTTTTTTTTTAATTCAACTTATTTAAAATTAATAAAGAGAAGTTTTTAAAAAGATAT ATGTTTATTATAATTAAAAAGGGGAAAACGAAAAAAAGAAAAGCATAGATGCACACATATATATATATATATATATATAT ATATATATATATATATATACAAATATATACATATATATATATATATAACATAATATTATATATTAATTATTACGAATACG CTAAGAACACTTCATAAGTGTTGAAGAAAAACAATATATACATTGGTAAATATAAATAACAGAATAATTACCAAAATGGG TATATTCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046551674839N975811321C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:40:58 on Mon 20 Nov 117.