EST 504657 is a singleton


Sequence

>504657 (1 EST) Length=405 TGACGATGTTGTAGAAAATAGTAGAGATGATAATAATAGTCTCTCTAATAGCGTAGATAATCAAAGTAATGTTTTAAATA GAGAAGATCCTATTGCTTCTGAAACTGAAGTTGTAAGTGAACCTGAGGATTCAAGTAGGATAATCACTACAGAAGTTCCA AGTACTACTGTAAAACCCCCTGATGAAAAACGATCTGAAGAAGTAGGAGAAAAAGAAGCTAAAGAAATTAAAGTAGAACC TGTTGTACCAAGAGCCATTGGAGAACCAATGGAAAATTCTGTGAGCGTACAGTCTCCTCCTAATGTAGAAGATGTTGAAA AAGAAACATTGATATCTGAGAATAATGGATTACATAATGATACACACAGAGGAAATATCAGTGAAAAGGATTTAATCGAT ATTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504657: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046571674841N975831323C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:42:54 on Fri 24 Nov 117.