EST 504661 is a singleton


Sequence

>504661 (1 EST) Length=252 GTTTTACCATAATATATTATTGTTTTATTTTTAAATAATTTTTTTTTTTTTTTCCGAAATTTATATTTCTTATATATCAA ATAATTAATATATATAAATATATTATTAATATATATTTAATACATGAAAAAATTATAGTTTTTTAATTTAATTATAATAT ATAATAATATATATATATTATTATATATATAATATATATATATTTGAATTTGTTAAAGCCACCCGAACATAACAAAACCG NNAATTTGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046611674845N975871333C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:42:22 on Sat 18 Nov 117.