EST 504663 is a singleton


Sequence

>504663 (1 EST) Length=273 AATAAAAAAATAAAAATTTCAAAAGGAAATATATATTATTATATATATAAATCATTGAGATATTTTTCTTAAGTACACAC TAAATAGAAACTAAAAAAAAAAAAAATATATAATAATAATAAAACATATTAGGGTNTATAATGACAAGTGAAGGAAGTAT NCAACTTAAAGATGATCAGTGGGATGTTATAAATTACAAAGATGGGAAGATCGTTAAATTATCACAAGTNGAATTAAATA ATGCTGTGAATATATATAATTGTGAGAATACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046631674847N975891335C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:17:29 on Fri 24 Nov 117.