EST 504664 is a singleton


Sequence

>504664 (1 EST) Length=336 TATATTATTATTATATCAAGCCAAAAAAAAAAAAAAAAAAAGGCTATTTTTGTATTTATTNACAAATATATATAAATATG GCTGAGCATTTAGCTCGAATTATTGGNACAGAAGAGGACAGAGTTANCTGCCCTTTTTTTTGGAAAATAGGTGCTTGCCG CCATGGTGACCAATGTAGTAGAAGTCATTATAAACCAAATTGTGCTCAGACATTAGTAATAAGACATATGTATGATAACC CACCTATAGCTGTTGCAATAGCAGAAGGCCAAATGGTAGAAGATGAAGTATTAGATAAAGCAGCTGACCATTTTGAAGAA TTTTATGAAGAAGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046641674848N975901337C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:1:56 on Sun 19 Nov 117.