EST 504665 is a singleton


Sequence

>504665 (1 EST) Length=230 AAAAAAAAATATATAACATTAAAAACAATAAAATAAATATAAAAAAAAAGAATTTGTATCTAAAAAAAAAAAAAAAAAAA ANTTACTATATTATAAATAGTTAAAATTTTAAAATATCCAAACTTATATGAATGCTTGTAAGAAATATGTTTATATAATA TTTGCTACATTGTATATTTGTATTTTTTTTTTTTTTTTGTTAGTATTTTTAAATTACTATTATTAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504665: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046651674849N975911338C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:38:3 on Fri 24 Nov 117.